Gene name |
SPAC19A8.09 |
Gene ID |
34/D09 |
Gene synonyms/obsolete |
|
Gene product |
ER to Golgi transprot
protein; conserved eukaryotic protein; similar to S.
cerevisiae YER074W-A; 1 predicted transmembrane helix;
predicted N-terminal signal sequence |
Entry clone |
Cloned |
ORF length (unspliced) |
375 |
ORF length (spliced) |
246 |
Entry clone length |
375 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC19A8.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGGGTTTGGAAATAT |
Rev primer name |
SPAC19A8.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCCCAAGACGAGGTTATAA |
Amino acid length |
81 |
Molecular weight |
9 |
Isoelectric point (calc.) |
10.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal |