| Gene name |
SPAC1F5.11c |
| Gene ID |
34/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
phosphatidylinositol
kinase; TPR repeat protein |
| Entry clone |
Cloned |
| ORF length (unspliced) |
11029 |
| ORF length (spliced) |
10968 |
| Entry clone length |
11029 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
1624A:G /
1702T:deletion / 1809C:T / 7365A:G / 7377T:C / 7771A:G /
8027A:G / 9649C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1F5.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAGACGGTTTTGAAAA |
| Rev primer name |
SPAC1F5.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGCCAAGCTTGCCAAAGT |
| Amino acid length |
3655 |
| Molecular weight |
420.7 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYAELIPLLL/LDFLLDLNI/LQTMGARLIL/LLEAFNSLLI/LCLTIPVRLSL/LEGLGRLLRL/LICVVEFSLRL/LLEVYDLCI/LENNVKLILNL/LSIYVMSLFI/LRDFVETKLDL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |