| Gene name |
SPAC823.03 |
| Gene ID |
34/F09 |
| Gene synonyms/obsolete |
SPAC1E11.03 |
| Gene product |
serine/threonine
protein kinase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1652 |
| ORF length (spliced) |
1605 |
| Entry clone length |
1652 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC823.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCGGATTCGCCCAT |
| Rev primer name |
SPAC823.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAAAATTCATCTACATTT |
| Amino acid length |
534 |
| Molecular weight |
61.4 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LCLVFELLSI/LGCILAELFL |
| Localization (YFP) |
SPB?; cytoplasmic dots
at cell tip; cytosol |
| Comments for localization |
cytoplasmic dots near
nucleus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal,
DeltaVision |