| Gene name |
SPAC22G7.08 |
| Gene ID |
34/G08 |
| Gene synonyms/obsolete |
|
| Gene product |
serine/threonine
protein kinase; similar to Sp SPAC1020.10 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1659 |
| ORF length (spliced) |
1542 |
| Entry clone length |
1659 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
201A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22G7.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGTGATCACGGAAGA |
| Rev primer name |
SPAC22G7.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATTAGAGTTTTCCGAACT |
| Amino acid length |
513 |
| Molecular weight |
58.5 |
| Isoelectric point (calc.) |
9.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol;
periphery, especially site of septum formation and cell
tip |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol; periphery at site of septum formation
and cell tip |
| Microscope used for
observation |
Leica |