Gene name |
SPCC1322.13 |
Gene ID |
34/G10 |
Gene synonyms/obsolete |
ade6; min1 |
Gene product |
phosphoribosylaminoimidazole carboxylase; AIR
carboxylase; involved in purine biosynthesis |
Entry clone |
Cloned |
ORF length (unspliced) |
1659 |
ORF length (spliced) |
|
Entry clone length |
1659 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
343A:G / 438A:T /
1174A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC1322.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCGAAAAACAGGTTGT |
Rev primer name |
SPCC1322.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGCAGAATAATTTTTCCAA |
Amino acid length |
552 |
Molecular weight |
60 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
except nucleolus |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |