Gene name |
SPBC409.08 |
Gene ID |
34/G11 |
Gene synonyms/obsolete |
|
Gene product |
membrane transporter;
unknown specificity |
Entry clone |
Cloned |
ORF length (unspliced) |
1662 |
ORF length (spliced) |
1620 |
Entry clone length |
1662 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
57A:G / 1293T:A /
1321A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC409.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTTGGAAAAGACAAA |
Rev primer name |
SPBC409.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAACAATAGCGGCCTTGGAT |
Amino acid length |
539 |
Molecular weight |
59.7 |
Isoelectric point (calc.) |
5.1 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAPNIACLLI |
Localization (YFP) |
no apparent signal
|
Comments for localization |
vacuole;
periphery? |
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
Confocal |