| Gene name |
SPAC22H10.07 |
| Gene ID |
34/H02 |
| Gene synonyms/obsolete |
ral3; scd2 |
| Gene product |
involved in
conjugation; involved in sporulation; involved in cellular
morphogenesis; src (SH3) homology domain; PX domain;
phosphoinositide binding; PB1 domain;
Ras1p-Scd1p-Scd2p-Cdc42p-Shk1p complex; interacts physically
with GTP-Cdc42p (effector CB1 and CB2); interacts physically
with Shk1p (effector CB2, target PXXP) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1664 |
| ORF length (spliced) |
1611 |
| Entry clone length |
1664 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
310A:G / 572T:C /
1028A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC22H10.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTAAAGGTATGCTTCAA |
| Rev primer name |
SPAC22H10.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACCTCCGTCTTTCTGCA |
| Amino acid length |
536 |
| Molecular weight |
60 |
| Isoelectric point (calc.) |
5.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVKLFFLPL |
| Localization (YFP) |
nucleus>cytosol;
periphery at cell tip and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |