| Gene name |
SPAC323.07c |
| Gene ID |
34/H03 |
| Gene synonyms/obsolete |
|
| Gene product |
MatE family
transporter; unknown specificity; similar to Sp SPCC4B3.13 and
SPAC11D3.06 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1664 |
| ORF length (spliced) |
1602 |
| Entry clone length |
1664 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
613A:G / 1659G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC323.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGCGTTTTTTCTCCAA |
| Rev primer name |
SPAC323.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACGTGGGTCAATCTATGA |
| Amino acid length |
533 |
| Molecular weight |
58.5 |
| Isoelectric point (calc.) |
7.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLILAVLHI/LHFSFHGMLMI/LCSRVAYSLAL |
| Localization (YFP) |
vacuole membrane |
| Comments for localization |
aggregates by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |