Gene name |
SPBC337.07c |
Gene ID |
34/H05 |
Gene synonyms/obsolete |
|
Gene product |
carboxypeptidase;
metalloprotease; peptidase family M14 |
Entry clone |
Cloned |
ORF length (unspliced) |
1665 |
ORF length (spliced) |
1494 |
Entry clone length |
1665 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
118T:C / 1081A:G /
1600A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC337.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTTACAATAAATCTCT |
Rev primer name |
SPBC337.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAATGCATACTCAGCGATA |
Amino acid length |
497 |
Molecular weight |
57.4 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LASQIVFVLFL/LESINSWLRL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |