| Gene name |
SPBC29A3.06 |
| Gene ID |
35/A03 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
CGI-48 family |
| Entry clone |
Cloned#/Sequence
mismatch |
| ORF length (unspliced) |
1671 |
| ORF length (spliced) |
|
| Entry clone length |
1671 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1557T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC29A3.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAAAAGATACTGAGGA |
| Rev primer name |
SPBC29A3.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATATAACAACGTCTACA |
| Amino acid length |
556 |
| Molecular weight |
62.7 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTCGFDRTLRI/LLGIQILIL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |