| Gene name |
SPBC15C4.06c |
| Gene ID |
35/A04 |
| Gene synonyms/obsolete |
SPBC21H7.01c |
| Gene product |
zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3); no
apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1671 |
| ORF length (spliced) |
|
| Entry clone length |
1671 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC15C4.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCATCTGTGTAATAACCA |
| Rev primer name |
SPBC15C4.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACATTGTCCTCGGAAGCA |
| Amino acid length |
556 |
| Molecular weight |
62.3 |
| Isoelectric point (calc.) |
6.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYIFIGVLLGL |
| Localization (YFP) |
periphery at cell tip
and site of septum formation; vacuole |
| Comments for localization |
weak signal of
periphery |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |