| Gene name |
SPBC17D11.06 |
| Gene ID |
35/B07 |
| Gene synonyms/obsolete |
pri2 |
| Gene product |
DNA primase (large
subunit); involved in telomere maintenance |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1680 |
| ORF length (spliced) |
1380 |
| Entry clone length |
1680 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
112G:A |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC17D11.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCAGAACGACCAAAAG |
| Rev primer name |
SPBC17D11.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGATTCTAAACTAAGTTGA |
| Amino acid length |
459 |
| Molecular weight |
53 |
| Isoelectric point (calc.) |
8.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
nucleus>cytosol |
| Comments for localization |
cytoplasmic dots at
fusion site during mating |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |