Gene name |
SPAC6F12.05c |
Gene ID |
35/E08 |
Gene synonyms/obsolete |
tnr3 |
Gene product |
thiamine
pyrophosphokinase (thiamine kinase); regulator of thiamine
metabolism; regulator of phosphate metabolism, mating, and
growth; Nudix family hydrolase |
Entry clone |
Cloned |
ORF length (unspliced) |
1710 |
ORF length (spliced) |
|
Entry clone length |
1710 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1380T:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6F12.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATGTCGTCTATCAC |
Rev primer name |
SPAC6F12.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATAGACGTGTTTCCATTGTC |
Amino acid length |
569 |
Molecular weight |
64.2 |
Isoelectric point (calc.) |
6.2 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNQVLHELEL |
Localization (YFP) |
cytosol; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |