Gene name |
SPAC9.10 |
Gene ID |
36/C04 |
Gene synonyms/obsolete |
|
Gene product |
amino acid permease
family; similar to Sp SPBC15C4.04C and SPAPB24D3.02C and
SPCC74.04 and SPAC1039.01 and SPAC11D3.08C and SPCC584.13 and
SPCC794.03 |
Entry clone |
Cloned |
ORF length (unspliced) |
1776 |
ORF length (spliced) |
|
Entry clone length |
1776 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
621T:C / 1268T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC9.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTTCTTCACAAATAAG |
Rev primer name |
SPAC9.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACCTTGAGTTCTTTAACG |
Amino acid length |
591 |
Molecular weight |
65 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
12 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |