| Gene name |
SPCC16A11.08 |
| Gene ID |
36/C11 |
| Gene synonyms/obsolete |
|
| Gene product |
sorting nexin; PX
domain; involved in intracellular protein transport;
phosphoinositide binding |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1782 |
| ORF length (spliced) |
1605 |
| Entry clone length |
1782 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
893C:T / 921A:G /
960T:C / 1135T:C / 1404A:G / 1496A:G / 1720A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC16A11.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCACAAGACGATTCTTA |
| Rev primer name |
SPCC16A11.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATATGTCCTTCGATAAATTT |
| Amino acid length |
534 |
| Molecular weight |
60.1 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
periphery |
| Comments for localization |
aggregates |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |