| Gene name |
SPAC24C9.01 |
| Gene ID |
36/H02 |
| Gene synonyms/obsolete |
cut11;
SPAC1786.03 |
| Gene product |
spindle pole body
docking protein; essential; 7 predicted transmembrane
helices |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1848 |
| ORF length (spliced) |
1806 |
| Entry clone length |
1848 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC24C9.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTCATGTTAAGGACTAG |
| Rev primer name |
SPAC24C9.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGAGTTGCTTTTGTATTCT |
| Amino acid length |
601 |
| Molecular weight |
69.3 |
| Isoelectric point (calc.) |
10.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRACFALLCL/LALTVEHLYL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |