| Gene name |
SPAC1556.02c |
| Gene ID |
37/C02 |
| Gene synonyms/obsolete |
sdh1 |
| Gene product |
succinate
dehydrogenase (ubiquinone); FAD binding domain; flavoprotein
subunit; involved in tricarboxylic acid cycle; involved in
mitochondrial electron transport, succinate to ubiquinone;
involved in succinate metabolism; succinate dehydrogenase
(ubiquinone) activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2047 |
| ORF length (spliced) |
1926 |
| Entry clone length |
2047 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
268A:T / 313T:C /
437A:G / 446A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1556.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTCAGATTTCGAAAAGT |
| Rev primer name |
SPAC1556.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAAACACGTTTGAAAGGA |
| Amino acid length |
641 |
| Molecular weight |
70.4 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
aggregates |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |