| Gene name |
SPAC14C4.14 |
| Gene ID |
37/C03 |
| Gene synonyms/obsolete |
atp1 |
| Gene product |
F1-ATPase (alpha
subunit); ATP synthesis coupled proton transport |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2049 |
| ORF length (spliced) |
1611 |
| Entry clone length |
2049 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
328A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC14C4.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTCGTCAAGCAGGTAC |
| Rev primer name |
SPAC14C4.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGAAAGAAGATAAAAATTCC |
| Amino acid length |
536 |
| Molecular weight |
58.5 |
| Isoelectric point (calc.) |
9.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ambiguous
structure |
| Comments for localization |
mitochondrion? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |