| Gene name |
SPAC1142.04 |
| Gene ID |
37/D08 |
| Gene synonyms/obsolete |
|
| Gene product |
involved in ribosome
biogenesis and assembly; similar to Sp SPAC1B3.09c; predicted
coiled-coil region |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2124 |
| ORF length (spliced) |
|
| Entry clone length |
2124 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
151G:A / 747C:T /
1485T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1142.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAAGTTATCTTCCAT |
| Rev primer name |
SPAC1142.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTCATCGATATCCTCTGCT |
| Amino acid length |
707 |
| Molecular weight |
81.1 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleolus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |