| Gene name |
SPBC19F5.02c |
| Gene ID |
37/E01 |
| Gene synonyms/obsolete |
|
| Gene product |
WD repeat protein;
ribonucleoprotein; processome component; involved in rRNA
processing |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2133 |
| ORF length (spliced) |
|
| Entry clone length |
2133 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1415A:G / 1427A:C /
1429A:G / 1446G:T / 1448G:A / 1479T:C / 2090A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19F5.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATATTCATCGTTGTCG |
| Rev primer name |
SPBC19F5.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGAGCCAAATTTGTGCTCA |
| Amino acid length |
710 |
| Molecular weight |
79.1 |
| Isoelectric point (calc.) |
8.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear dots;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |