| Gene name |
SPCC1259.14c |
| Gene ID |
37/H10 |
| Gene synonyms/obsolete |
meu27; B8647-6 |
| Gene product |
possibly Sp specific;
Pfam_B_8647 domain; NLS; meiotic expression upregulated |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2211 |
| ORF length (spliced) |
|
| Entry clone length |
2211 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1038A:G / 1584G:A /
1682C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1259.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAGTAAAATTGCTTA |
| Rev primer name |
SPCC1259.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACATCATTGTACCCAAT |
| Amino acid length |
736 |
| Molecular weight |
83.8 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
717/716/718 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |