| Gene name |
SPBC244.01c |
| Gene ID |
37/H11 |
| Gene synonyms/obsolete |
sid4 |
| Gene product |
SIN component scaffold
protein; involved in cytokinesis; localizes components of the
SIN to the SPB; septation initiation pathway; mutant septum
initiation defective; interacts physically with Cdc11p (IAP);
coiled-coil region; no apparent orthologs |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2203 |
| ORF length (spliced) |
1983 |
| Entry clone length |
2203 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2046T:C /
2172A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC244.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATGAGGCTTTTGGTGA |
| Rev primer name |
SPBC244.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAAACTACGTTTTTTAAGC |
| Amino acid length |
660 |
| Molecular weight |
74.4 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKTVLVQLNI |
| Localization (YFP) |
cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |