| Gene name |
SPBP8B7.30c |
| Gene ID |
38/D11 |
| Gene synonyms/obsolete |
|
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain; predicted membrane-tethered
transcription factor; NLS (bipartite) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2574 |
| ORF length (spliced) |
|
| Entry clone length |
2574 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
751T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP8B7.30.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTGTCCCTCTGACTTTTC |
| Rev primer name |
SPBP8B7.30.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATGGTCCTAAACGATTCAAT |
| Amino acid length |
857 |
| Molecular weight |
95.5 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
Predicted
(N-terminus); NLS (bipartite) |
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNSVLASLQL/LSSSLLPLEL/LRVLASFLYI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |