Gene name |
SPAC24H6.13 |
Gene ID |
38/F07 |
Gene synonyms/obsolete |
|
Gene product |
eukaryotic conserved
protein; Sc homolog RSN1 is involved in tunicamycin
sensitivity; DUF221 |
Entry clone |
Cloned |
ORF length (unspliced) |
2616 |
ORF length (spliced) |
|
Entry clone length |
2616 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
389T:C / 2116A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC24H6.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGACAGCAGCAGTTC |
Rev primer name |
SPAC24H6.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAACTCCTGATCGCCTCATCG |
Amino acid length |
871 |
Molecular weight |
98.4 |
Isoelectric point (calc.) |
9.3 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
11 |
NLS position (Columbia Univ.
Bioinformatics Center) |
247/222 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFTFGALCI/LLQIVTLLL/LFQVFVGLYL/LTGFDRVLQL |
Localization (YFP) |
Golgi; periphery;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |