Gene name |
SPAC1039.05c |
Gene ID |
38/G08 |
Gene synonyms/obsolete |
|
Gene product |
fungal conserved
protein; zinc finger protein; zf-C2H2 type; similar to Sp zas1
(paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
2651 |
ORF length (spliced) |
2346 |
Entry clone length |
2651 |
No. of intron |
5 |
Sequence status |
Finished |
Sequence results |
106A:G / 693A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1039.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCAAGGCGAAAAAAAG |
Rev primer name |
SPAC1039.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAGCTGTACTAATTTAGAC |
Amino acid length |
781 |
Molecular weight |
89 |
Isoelectric point (calc.) |
7.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots; nucleus;
spindle microtubules |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |