| Gene name |
SPAC22F3.13 |
| Gene ID |
39/A02 |
| Gene synonyms/obsolete |
tsc1 |
| Gene product |
putative coiled coil
protein hamartin-like protein; similar to human TSC1 (tuberous
sclereosis 1); involved in vesicular transport; involved in
cell growth arrest (implicated); predicted to interact with
SPAC630.13c (tuberin); deletion mutant defective in nutrient
uptake; deletion mutant defective in conjugation; involved in
conjugation; involved in protein trafficking; no apparent Sc
ortholog |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
2700 |
| ORF length (spliced) |
|
| Entry clone length |
2700 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC22F3.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGCTGCAATCGCTAGT |
| Rev primer name |
SPAC22F3.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTATTGGCGAAACGTAGAA |
| Amino acid length |
899 |
| Molecular weight |
103.4 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKTVIPLLIL/LSYALSFILMI |
| Localization (YFP) |
cytoplasmic dots
|
| Comments for localization |
strong signal of
aggregates by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |