| Gene name |
SPBC19C2.09 |
| Gene ID |
39/A03 |
| Gene synonyms/obsolete |
|
| Gene product |
putative DNA-binding
protein membrane-tethered transcription factor; basic
helix-loop-helix (bHLH); DNA binding protein; Myc type
dimerisation domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2703 |
| ORF length (spliced) |
|
| Entry clone length |
2703 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
209A:T / 2691T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC19C2.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAAGCTCAATTCCGTC |
| Rev primer name |
SPBC19C2.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTGATGAAACATAACCC |
| Amino acid length |
900 |
| Molecular weight |
98.4 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
2 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNGMVGLGL/LKIGVVLLGL/LFTLHSCLSL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |