| Gene name |
SPBC8D2.07c |
| Gene ID |
39/F11 |
| Gene synonyms/obsolete |
sfc9 |
| Gene product |
hypothetical protein;
RNA polymerase III transcription factor (TFIIIC subunit); by
similarity to human hTFIIIC90 subunit; no apparent Sc
ortholog; predicted C-terminal zinc finger (by eye) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2326 |
| ORF length (spliced) |
2022 |
| Entry clone length |
2326 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
258T:C / 376A:G /
1596T:C / 1978T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC8D2.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGAAAGGATGTAGCATT |
| Rev primer name |
SPBC8D2.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGAAACCAAGAAATGTCCA |
| Amino acid length |
673 |
| Molecular weight |
74.8 |
| Isoelectric point (calc.) |
5.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LANVEYLAL/LLNSLRYRLTL/LLADLQNELSI |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |