| Gene name |
SPAC15A10.03c |
| Gene ID |
39/G01 |
| Gene synonyms/obsolete |
rhp54; rad54 |
| Gene product |
DNA repair protein
Rhp54 DEAD/DEAH box helicase; SNF2 family; helicase C-terminal
domain; DNA dependent ATPase activity; DNA supercoiling
activity; involved in DNA repair; deletion mutant sensitive to
UV; deletion mutant sensitive to ionizing radiation); deletion
mutant results in elongated cells (frequent); deletion mutant
results in aberrant nuclei (occasional); deletion mutant
results in a high level of chromosome loss; involved in
meiotic recombination; involved in DNA repair; involved in
chromatin remodeling; involved in heteroduplex formation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2559 |
| ORF length (spliced) |
|
| Entry clone length |
2559 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
344T:C / 2040T:C /
2103T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC15A10.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTCAGCAACCAACAAC |
| Rev primer name |
SPAC15A10.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGAGATTTGTATTGGAAA |
| Amino acid length |
852 |
| Molecular weight |
96.6 |
| Isoelectric point (calc.) |
9.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus; nuclear dots;
spindle microtubules |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |