Gene name |
SPBC16C6.11 |
Gene ID |
39/G09 |
Gene synonyms/obsolete |
rpl3201; rpl32-1 |
Gene product |
60S ribosomal protein
L32 |
Entry clone |
Cloned |
ORF length (unspliced) |
384 |
ORF length (spliced) |
|
Entry clone length |
384 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC16C6.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTGCAATCAACATTGT |
Rev primer name |
SPBC16C6.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTTGAGAACGAACTTTA |
Amino acid length |
127 |
Molecular weight |
14.4 |
Isoelectric point (calc.) |
11.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol;
nucleolus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol, partially; nucleolus |
Microscope used for
observation |
Leica |