| Gene name |
SPBC649.04 |
| Gene ID |
39/H08 |
| Gene synonyms/obsolete |
uvi15 |
| Gene product |
UV induced protein
required for the maintenance of viability of cells in
stationary phase and in starvation condition; induced by UV;
induced by stress; induced by alkylating agents and heat
shock; Fibrillarin binds to a 3' cis-regulatory element in
pre-mRNA; non-essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
543 |
| ORF length (spliced) |
264 |
| Entry clone length |
543 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC649.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGCTCAACAGTTTTA |
| Rev primer name |
SPBC649.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAACATTGCATCCAAACAG |
| Amino acid length |
87 |
| Molecular weight |
9.3 |
| Isoelectric point (calc.) |
3.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
periphery at cell tip
and site of septum formation |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |