| Gene name |
SPBC337.14 |
| Gene ID |
39/H10 |
| Gene synonyms/obsolete |
rpb4 |
| Gene product |
DNA-directed RNA
polymerase subunit DNA-directed RNA polymerase II (subunit);
essential; involved in transcription from Pol II promoter;
DNA-directed RNA polymerase activity (function of complex);
interacts physically with Rpb7p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
565 |
| ORF length (spliced) |
408 |
| Entry clone length |
565 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
66T:C / 80A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC337.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGAGGGCTATTTTTGA |
| Rev primer name |
SPBC337.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTTGAAATTTACGCAAA |
| Amino acid length |
135 |
| Molecular weight |
15.3 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus;
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |