Gene name |
SPBC146.07 |
Gene ID |
40/F01 |
Gene synonyms/obsolete |
mis11; prp2 |
Gene product |
RNA-binding protein;
involved in mRNA splicing (IGI); SR family; U2AF large subunit
(U2AF-59); rrm RNA recognition motif; SF1-U2AF(59)-U2AF(23)
complex; involved in pre-spliceosome formation; similar to
human U2AF54 |
Entry clone |
Cloned# |
ORF length (unspliced) |
1554 |
ORF length (spliced) |
|
Entry clone length |
1554 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC146.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTGTCTTCCAGATT |
Rev primer name |
SPBC146.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCATGCATTAGCTTTATAG |
Amino acid length |
517 |
Molecular weight |
58.9 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
74/75 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |