| Gene name |
SPBC646.09c |
| Gene ID |
40/F02 |
| Gene synonyms/obsolete |
int6; yin6 |
| Gene product |
eIF3 p48 subunit
eIF3/signalosome component; PCI domain; potential regulator
for microtubule function; involved in chromosome segregation;
chromosome segregation; interacts physically with Moe1p; froms
a complex with Moe1p; interacts physically with Scd1p;
interacts physically with Rpn5p; regulates the proteasome by
affecting its localization/assembly; cooperates with Ras1p to
mediate chromosome segregation; no apparent Sc ortholog;
deletion mutant results in inefficient separation of sister
chromatids; deletion mutant results in slow growth (at low
temperatures); disease associated, breast tumorigenesis;
functionally complemented by human INT6; deletion mutant is
proteosome defective |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
1562 |
| ORF length (spliced) |
1506 |
| Entry clone length |
1562 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC646.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGATCCGAGCTTAAGAG |
| Rev primer name |
SPBC646.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACAGTAGCATGCTTTAAC |
| Amino acid length |
501 |
| Molecular weight |
57.1 |
| Isoelectric point (calc.) |
4.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIFPLLEFLSL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol=nucleus |
| Microscope used for
observation |
DeltaVision |