Gene name |
SPBC21C3.18 |
Gene ID |
40/F07 |
Gene synonyms/obsolete |
spo4 |
Gene product |
serine/threonine
protein kinase; involved in sporulation (required); involved
in spindle formation (meiotic); involved in ascospore
formation (required); essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1672 |
ORF length (spliced) |
1290 |
Entry clone length |
1672 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC21C3.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTTCCATGCTATTACC |
Rev primer name |
SPBC21C3.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTGCTCTACAGTTGAAGGG |
Amino acid length |
429 |
Molecular weight |
49.1 |
Isoelectric point (calc.) |
6.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus;
cytoplasmic dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |