Gene name |
SPAC1783.07c |
Gene ID |
40/F06 |
Gene synonyms/obsolete |
pap1 |
Gene product |
ap-1-like
transcription factor; bZIP (basic leucine zipper)
transcription factor family; stress induced transcription
factor; involved in oxidative stress response (required) |
Entry clone |
Cloned |
ORF length (unspliced) |
1659 |
ORF length (spliced) |
|
Entry clone length |
1659 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1229T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC1783.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGGACAAACTGAGAC |
Rev primer name |
SPAC1783.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTAAATTGATTTAAAGCC |
Amino acid length |
552 |
Molecular weight |
61.5 |
Isoelectric point (calc.) |
5.3 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
64/80 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus |
Microscope used for
observation |
DeltaVision |