| Gene name |
SPAC1783.07c |
| Gene ID |
40/F06 |
| Gene synonyms/obsolete |
pap1 |
| Gene product |
ap-1-like
transcription factor; bZIP (basic leucine zipper)
transcription factor family; stress induced transcription
factor; involved in oxidative stress response (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1659 |
| ORF length (spliced) |
|
| Entry clone length |
1659 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1229T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1783.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCGGACAAACTGAGAC |
| Rev primer name |
SPAC1783.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTAAATTGATTTAAAGCC |
| Amino acid length |
552 |
| Molecular weight |
61.5 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
64/80 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus |
| Microscope used for
observation |
DeltaVision |