| Gene name |
SPBC13E7.10c |
| Gene ID |
40/G02 |
| Gene synonyms/obsolete |
SPBC30D10.20 |
| Gene product |
transcription factor
TFIIIB complex; involved in transcription from Pol III
promoter; TATA-dependentpathway; interacts physically with
Sfc4p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1830 |
| ORF length (spliced) |
1503 |
| Entry clone length |
1830 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
45C:addition |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC13E7.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTAGTATGCATATTTGC |
| Rev primer name |
SPBC13E7.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACGACTGCTCTTCGTCAAAT |
| Amino acid length |
500 |
| Molecular weight |
56.7 |
| Isoelectric point (calc.) |
6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
449 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LIDFSDILQI/LCRVLRPNLPL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |