Gene name |
SPBC9B6.10 |
Gene ID |
40/G03 |
Gene synonyms/obsolete |
cdc37 |
Gene product |
chaperone; regulator
of Spc SAPK cascade (positive); interacts physically with
SPAC24B11.06c |
Entry clone |
Cloned |
ORF length (unspliced) |
1832 |
ORF length (spliced) |
1401 |
Entry clone length |
1832 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC9B6.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTGATTACAGCAA |
Rev primer name |
SPBC9B6.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGACAATTGAGGAATAGTC |
Amino acid length |
466 |
Molecular weight |
52.5 |
Isoelectric point (calc.) |
4.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |