Gene name |
SPBC36.05c |
Gene ID |
40/G04 |
Gene synonyms/obsolete |
clr6 |
Gene product |
transcriptional
regulator; cryptic loci regulator; histone deacetylase
activityj; NAD-independent histone deacetylase activity;
RPD3-like (class I); involved in transcriptional regulation;
involved in chromatin silencing; involved in chromatin
assembly/disassembly; essential |
Entry clone |
Cloned |
ORF length (unspliced) |
1850 |
ORF length (spliced) |
1218 |
Entry clone length |
1850 |
No. of intron |
13 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC36.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGTTCGGGAAGAAAAA |
Rev primer name |
SPBC36.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATACGCGCTCATCCATAATC |
Amino acid length |
405 |
Molecular weight |
46.1 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
Microscope used for
observation |
DeltaVision |