| Gene name |
SPBC30D10.11 |
| Gene ID |
40/G07 |
| Gene synonyms/obsolete |
gpi1 |
| Gene product |
N-acetylglucosaminyl
transferase component; involved in GPI anchor biosynthesis
(1st step); involved in cytokinesis; involved in cell
separation; essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1962 |
| ORF length (spliced) |
|
| Entry clone length |
1962 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
909C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC30D10.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTACCACAACCATGAA |
| Rev primer name |
SPBC30D10.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCGTAAGGAAATTTTTTC |
| Amino acid length |
653 |
| Molecular weight |
76.4 |
| Isoelectric point (calc.) |
9.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
6 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEPLSLLLL/LFAYFIILLRI/LRVIYSLLQL |
| Localization (YFP) |
ER with
discontinuity |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |