| Gene name |
SPBC21.06c |
| Gene ID |
41/A10 |
| Gene synonyms/obsolete |
cdc7 |
| Gene product |
serine/threonine
protein kinase; SIN component; involved in septation
(required); involved in cytokinesis (required);
essential |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3650 |
| ORF length (spliced) |
3189 |
| Entry clone length |
3650 |
| No. of intron |
10 |
| Sequence status |
Finished |
| Sequence results |
3636C:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC21.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCACAATATCCAAGCATC |
| Rev primer name |
SPBC21.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTGCGTTAATGGCTGCTTT |
| Amino acid length |
1062 |
| Molecular weight |
119.2 |
| Isoelectric point (calc.) |
7.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRRILRILLYL/LSMVPSSLSL |
| Localization (YFP) |
nuclear dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |