| Gene name |
SPBC29A3.14c |
| Gene ID |
41/A09 |
| Gene synonyms/obsolete |
trt1 |
| Gene product |
telomerase catalytic
subunit; reverse transcriptase 1 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3639 |
| ORF length (spliced) |
2967 |
| Entry clone length |
3639 |
| No. of intron |
15 |
| Sequence status |
Finished |
| Sequence results |
727A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC29A3.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACCGAACACCATACCCC |
| Rev primer name |
SPBC29A3.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAGCTATTCTTCTATGT |
| Amino acid length |
988 |
| Molecular weight |
116.3 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
197/196 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKDLETFLKL/LLRVVDDFLFI/LRPVLRQVLFL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |