Gene name |
SPBC25H2.13c |
Gene ID |
41/B02 |
Gene synonyms/obsolete |
cdc20; pol2 |
Gene product |
DNA polymerase epsilon
(catalytic subunit a); involved in telomere maintenance |
Entry clone |
Cloned#/ 3' FS |
ORF length (unspliced) |
6600 |
ORF length (spliced) |
|
Entry clone length |
6600 |
No. of intron |
0 |
Sequence status |
planning for
re-cloning |
Sequence results |
6512T:C /
6584T:deletion |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC25H2.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCCTTAAAAACAGCTCG |
Rev primer name |
SPBC25H2.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTCAGCACAGAAAGTATG |
Amino acid length |
2199 |
Molecular weight |
252.8 |
Isoelectric point (calc.) |
7.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLKSIKTLPL/LKKSLLSLLQI/LVDNLYHQLTL |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |