Gene name |
SPBC11B10.10c |
Gene ID |
41/D01 |
Gene synonyms/obsolete |
pht1; pi001 |
Gene product |
histone h2a variant;
involved in chromosome stability; involved in chromatin
assembly/disassembly; chromatin assembly complex |
Entry clone |
Cloned |
ORF length (unspliced) |
516 |
ORF length (spliced) |
|
Entry clone length |
516 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
343T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC11B10.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATATTAAGACACGCACC |
Rev primer name |
SPBC11B10.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAATAATTTCTTCCTCCTCG |
Amino acid length |
171 |
Molecular weight |
18.8 |
Isoelectric point (calc.) |
10.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPHINKQLLI |
Localization (YFP) |
nucleus;
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |