| Gene name |
SPBC13A2.01c |
| Gene ID |
41/E09 |
| Gene synonyms/obsolete |
|
| Gene product |
nuclear cap-binding
complex (small subunit); RNA-binding protein; rrm RNA
recognition motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
738 |
| ORF length (spliced) |
549 |
| Entry clone length |
738 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC13A2.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCATCAATAACAAGGTT |
| Rev primer name |
SPBC13A2.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTTTTTTTCCAACGATTG |
| Amino acid length |
182 |
| Molecular weight |
20.7 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
spindle microtubules;
nucleus>>cytosol; nuclear dots |
| Comments for localization |
bright dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |