| Gene name |
SPAC12B10.13 |
| Gene ID |
41/F08 |
| Gene synonyms/obsolete |
|
| Gene product |
conserved
hypothetical; conserved protein; CTLH domain; similar to human
BA305P22.1; similar to A. thaliana F11P17.12 and T30A10.60;
similar to D. melanogaster CG6617 and CG18467; no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
831 |
| ORF length (spliced) |
723 |
| Entry clone length |
831 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC12B10.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAGGCACTTCTTCTTT |
| Rev primer name |
SPAC12B10.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTATGGATGCTTTGGGC |
| Amino acid length |
240 |
| Molecular weight |
27 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLFELLRLRL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |