Gene name |
SPCC622.03c |
Gene ID |
42/A11 |
Gene synonyms/obsolete |
|
Gene product |
Sp specific families;
hypothetical protein; possibly Sp specific; similar to Sp
SPCC622.06c; tandem duplication |
Entry clone |
Cloned |
ORF length (unspliced) |
399 |
ORF length (spliced) |
|
Entry clone length |
399 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC622.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCCAAAGAAATCCAT |
Rev primer name |
SPCC622.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATACCTCTGATATGGAGAA |
Amino acid length |
132 |
Molecular weight |
15.3 |
Isoelectric point (calc.) |
9.6 |
Signal SEQ |
|
No. of transmembrane domain |
2 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LILIVLAMLFI |
Localization (YFP) |
cytoplasmic dots;
periphery |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |