| Gene name |
SPAC343.18 |
| Gene ID |
42/H04 |
| Gene synonyms/obsolete |
|
| Gene product |
zf-C3HC4 type (RING
finger); ubiquitin ligase (E3); similar to Sp SPAC19A8.10
(paralog); no apparent Sc ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
671 |
| ORF length (spliced) |
618 |
| Entry clone length |
671 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC343.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATCTGCATGGACTAGA |
| Rev primer name |
SPAC343.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAAATATAAAGGAAATATA |
| Amino acid length |
205 |
| Molecular weight |
23 |
| Isoelectric point (calc.) |
9.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |