Gene name |
SPAC4G9.11c |
Gene ID |
42/H05 |
Gene synonyms/obsolete |
cmb1 |
Gene product |
HMG box mismatch
binding protein vHMG box; involved in DNA repair; involved in
mismatch repair; binds to cytosines in base mismatches and
opposite chemically altered guanines |
Entry clone |
Cloned |
ORF length (unspliced) |
672 |
ORF length (spliced) |
|
Entry clone length |
672 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
4C:T |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC4G9.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCGTCTGTTTGACGCAAT |
Rev primer name |
SPAC4G9.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCGAAATCCGGCTTCTTTC |
Amino acid length |
223 |
Molecular weight |
26.3 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |