| Gene name |
SPAC17H9.09c |
| Gene ID |
43/A06 |
| Gene synonyms/obsolete |
ras1; ste5 |
| Gene product |
small GTPase; Ras
family; Ras1p-Scd1p-Scd2p-Cdc42p-Shk1p complex; involved in
conjugation (regulation); involved in morphogenesis
(regulation); involved chromosome segregation (regulation);
activator of Scd1p; activator of Byr2p; deletion can worsen
the growth defect of moe1; palmitoylated |
| Entry clone |
Cloned |
| ORF length (unspliced) |
731 |
| ORF length (spliced) |
660 |
| Entry clone length |
731 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC17H9.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGGGTAAGTCTAAGCAA |
| Rev primer name |
SPAC17H9.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACATATAACACAACATTTA |
| Amino acid length |
219 |
| Molecular weight |
24.7 |
| Isoelectric point (calc.) |
5.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |